93
|
Addgene inc
raptor mutants Raptor Mutants, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdnas+of+mut-2%2C+mut-3+and+mut-4/HA+Raptor+(Plasmid+%238513)/pmc06172959-671-5-35 Average 93 stars, based on 1 article reviews
raptor mutants - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
cdnas of mut-2, mut-3 and mut-4 Cdnas Of Mut 2, Mut 3 And Mut 4, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdnas+of+mut-2%2C+mut-3+and+mut-4/prlr+mut3++3++/pmc02818841-51-6-23 Average 90 stars, based on 1 article reviews
cdnas of mut-2, mut-3 and mut-4 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
pproex-1 Pproex 1, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdnas+of+mut-2%2C+mut-3+and+mut-4/pproex+1/pmc02818841-51-9-23 Average 90 stars, based on 1 article reviews
pproex-1 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Promega
gel shift assay system Gel Shift Assay System, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdnas+of+mut-2%2C+mut-3+and+mut-4/gel+shift+assay+system/pmc02655695-59-7-11 Average 90 stars, based on 1 article reviews
gel shift assay system - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Promega
pbind Pbind, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdnas+of+mut-2%2C+mut-3+and+mut-4/pbind/pmc03273392-323-63-9 Average 90 stars, based on 1 article reviews
pbind - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Bio Link Co Ltd
dnmt2 plasmid Dnmt2 Plasmid, supplied by Bio Link Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdnas+of+mut-2%2C+mut-3+and+mut-4/dnmt2+plasmid/pmc09842506-65-0-20 Average 90 stars, based on 1 article reviews
dnmt2 plasmid - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
99
|
Abcam
insulin Insulin, supplied by Abcam, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdnas+of+mut-2%2C+mut-3+and+mut-4/Anti-Insulin+%2B+Proinsulin+antibody/pm24879834-199-86-103 Average 99 stars, based on 1 article reviews
insulin - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
90
|
Shanghai GenePharma
reporter plasmids ac016405.3-luc-mut  Reporter Plasmids Ac016405.3 Luc Mut, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdnas+of+mut-2%2C+mut-3+and+mut-4/ac016405+3+overexpression+plasmids+ac016405+3+wt/pmc06500966-113-6-30 Average 90 stars, based on 1 article reviews
reporter plasmids ac016405.3-luc-mut - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
97
|
Vazyme Biotech Co
mut express ii fast mutagenesis kit v2 Mut Express Ii Fast Mutagenesis Kit V2, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdnas+of+mut-2%2C+mut-3+and+mut-4/Mut+Express+II+Fast+Mutagenesis+Kit+V2/custom%40c214%4036898847 Average 97 stars, based on 1 article reviews
mut express ii fast mutagenesis kit v2 - by Bioz Stars,
2026-09
97/100 stars
|
Buy from Supplier |
90
|
InterPro Inc
flag-parp12 mut1 Flag Parp12 Mut1, supplied by InterPro Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdnas+of+mut-2%2C+mut-3+and+mut-4/flag+parp12+mut1/pmc05656619-85-30-2 Average 90 stars, based on 1 article reviews
flag-parp12 mut1 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
NeoGenomics
immunofluorescence multiplex immunohistochemistry platform Immunofluorescence Multiplex Immunohistochemistry Platform, supplied by NeoGenomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdnas+of+mut-2%2C+mut-3+and+mut-4/multiomyx+mif+ihc+til+panel/pmc08293967__KONI_A_1928365_SM5782-8-545-549 Average 90 stars, based on 1 article reviews
immunofluorescence multiplex immunohistochemistry platform - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Midland Certified Reagent
caggacctgagtctcccaaggtcatccttgttttgacttgta Caggacctgagtctcccaaggtcatccttgttttgacttgta, supplied by Midland Certified Reagent, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdnas+of+mut-2%2C+mut-3+and+mut-4/caggacctgagtctcccaaggtcatccttgttttgacttgta/pm09832447-72-27-36 Average 90 stars, based on 1 article reviews
caggacctgagtctcccaaggtcatccttgttttgacttgta - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cancer Science
Article Title: AC016405.3, a novel long noncoding RNA, acts as a tumor suppressor through modulation of TET2 by microRNA‐19a‐5p sponging in glioblastoma
doi: 10.1111/cas.14002
Figure Lengend Snippet: Association of AC016405.3 expression with clinicopathological features of GBM
Article Snippet: Wild and mutant reporter plasmids of
Techniques: Expressing, Mutagenesis